-

Risultati 1 - 10 su circa 16 per  Wikiversity  / PCR Messina operone rna /  Wikiversity     (9554 articoli)

Introduzione all'Ingegneria Genetica (superiori) print that page

C_elegans_stained

numerosi geni che, trascritti, vanno incontro a splicing alternativo . Esistono numerosi trascritti di RNA che non vengono a loro volta tradotti. Non esiste nemmeno una cifra certa dei geni presenti nel genoma umano: le stime proposte al termine del sequenziamento del genoma (circa 30-40000

Dal DNA alla proteina (superiori) print that page

ATCTGATGTGACGATAATCGTGTTAGTAGCTTAGACACAACGTGTGCGATTATAAAACAGAGCTGAGCGCGTGTGCCTTTAATAGGATCAGAATCGATAAAGAGTTTATAGCTAGCTAGTCTAAACGAGTTATCGATCGATCGATCGTGTGCTCTGATGTGACGATAATCGTGGAATAGTTCTAGACACAACGTTGTGCGATTTTTATACAGAGCTGAGCGCGTGTAAAGCCATTAGGATC L RNA messaggero copia il gene [ modifica ] Nel

wikiversity.org | 2017/9/8 23:12:21

Introduzione alla Biochimica (superiori) print that page

Biologia_molecolare_-_Biochimica_-_Genetica

ampiamente descritta. Altre aree della biochimica includono lo studio del codice genetico (DNA, RNA ), la sintesi proteica, il meccanismo di trasporto della membrana cellulare e la trasduzione del segnale. Sviluppo della biochimica [ modifica ] Originariamente si credeva che la vita non fosse

Liceo scientifico - Scienze applicate/Scienze naturali print that page

LINEE GENERALI E COMPETENZE Al termine del percorso liceale lo studente possiede le conoscenze disciplinari e le metodologie tipiche delle scienze della Terra, della chimica e della biologia. Queste diverse aree disciplinari sono caratterizzate da concetti e da metodi di indagine propri, ma

wikiversity.org | 2016/6/28 22:18:18

DNA, cromosomi, geni (superiori) print that page

Allium_cepa-cell_nucleus

specializza usando solo le informazioni che le servono. Il DNA non esce dal nucleo: è compito dell RNA messaggero (mRNA) copiare le porzioni di DNA che servono (geni) e portare l'informazione fuori dal nucleo (nei ribosomi). Cromosomi [ modifica ] Il disegno sopra mostra un ipotetico

Replicazione del DNA print that page

elica "stampo". Per risolvere questo problema entra in gioco la primasi : un particolare tipo di RNA polimerasi (l'enzima che trascrive il codice genetico non come DNA ma come RNA ) che si piazza accanto all'elicasi (e insieme formano il primosoma ) e in alcuni punti dei due filamenti che

wikiversity.org | 2018/1/8 23:08:30

Esercizi su Dal DNA alla proteina (superiori) print that page

Esercizio 7 2.8 Esercizio 8 2.9 Esercizio 9 2.10 Esercizio 10 3 Esercizi sul passaggio da RNA alla proteina 3.1 Esercizio 1 3.2 Esercizio 2 3.3 Esercizio 3 3.4 Esercizio 4 3.5 Esercizio 5 3.6 Esercizio 6 3.7 Esercizio 7 3.8 Esercizio 8 3.9 Esercizio 9 3.10 Esercizio

wikiversity.org | 2017/9/8 23:17:37

Organismi geneticamente modificati print that page

EscherichiaColi_NIAID

Per organismi geneticamente modificati si intendono le tecniche che comportano l'introduzione diretta in un organismo di materiale ereditabile preparato al suo esterno, tra cui la microiniezione, la macroiniezione e il microincapsulamento; Fusione cellulare (inclusa la fusione di protoplasti

Biomolecole print that page

Ogni essere vivente è fatto di cellule, e ogni cellula è fatta di molecole : molecole spesso enormi ed estremamente complesse, ma tutte molecole composte di atomi, che seguono le normali leggi della fisica e della chimica. Indice 1 Gli elementi della vita 2 Carboidrati 3 Lipidi

wikiversity.org | 2017/11/25 4:37:03

La cellula eucariote (superiori) print that page

Disegno_della_cellula_animale

c: MEMBRANA NUCLEARE: è una doppia membrana che presenta dei "buchi" detti pori nucleari. d: RNA MESSAGGERO: è una copia di una porzione di DNA, che verrà portata all'esterno fino ai ribosomi e: PORI NUCLEARI: permettono all RNA messaggero di uscire dal nucleo 2. RETICOLO ENDOPLASMATICO